Collection and processing of samples
From the fall of 2020, all employees and students on the Rockefeller University Campus (approximately 1400 people) were tested at least weekly with a saliva-based PCR test developed in the Darnell Clinical Laboratory Improvement Amendments – Clinical Laboratory Evaluation Program laboratory (approval number, PFI- 9216) and approved for clinical use by an emergency use permit in New York State. Protocols for the collection of saliva samples for clinical SARS-CoV-2 testing have been reviewed by the Institutional Review Board at Rockefeller University and are not considered to be research on human subjects. Institutional Review Board obtained written informed consent for the analysis of patient 1 antibody titers and the study was conducted in accordance with the International Council for Harmonization of Good Clinical Practice guidelines.
In accordance with New York State regulations on fitness, 417 employees who received a second dose of BNT162b2 (Pfizer – BioNTech) or mRNA-1273 (Moderna) at least 2 weeks in advance were tested between 21 January and 17 March 2021. . , and weekly testing was continued thereafter. The demographic characteristics of these 417 persons and of 1491 non-vaccines tested in parallel at Rockefeller University during the same period are shown in Table S1 of the supplementary appendix, available with the full text of this article on NEJM.org.
The employees and students were instructed to give a saliva sample in a medicine beaker and transfer 300 μl into a vial that buffered 300 μl of Darnell Rockefeller University Laboratory (DRUL) (5 M guanidient thiocyanate, 0.5% sarcosyl and 300 μl). mM sodium contains) acetate [pH 5.5]).2 Samples were processed on the Thermo KingFisher Apex system for rapid RNA purification, and complementary DNA (cDNA) was amplified using TaqPath 1-step RT-qPCR (reverse transcriptase quantitative PCR) Master Mix (Thermo Fisher Scientific) and multiplexed primers and probes validated under an emergency food and drug administration permit (Table S2) with the 7500 Fast Dx Real-Time PCR tracking system (Applied Biosystems). Samples are considered interpretable if the cycle threshold (Ct) of the home control (Ct) was less than 40, and viral RNA is considered to be detected with both viral primers and probes (N1 and N2, which detect two regions of the nucleocapsid. [N] none of SARS-CoV-2) at a Ct of less than 40.
Calculation of viral load
We calculated the viral load per milliliter of saliva using chemically inactivated SARS-CoV-2 (ZeptoMetrix) administered at different dilutions in saliva. Extractions and RT-PCR were performed as previously described to determine the corresponding Ct values for each dilution (Fig. S1).
Targeted order
Reverse transcription of RNA samples was performed according to the manufacturer’s instructions with the iScript mixture (Bio-Rad). PCR amplification of cDNA was performed using two primer sets (primer set 1: forward primer 1 [CCAGATGATTTTACAGGCTGC] and inverted primer 1 [CTACTGATGTCTTGGTCATAGAC]; primer 2: forward primer 2 [CTTGTTTTATTGCCACTAGTC] and reverse underlayer 1). PCR products were then extracted from gel and sent to Genewiz for Sanger sequence.
Neutralization provision
Neutralization assays with pseudotypic replication-defective human immunodeficiency virus type 1, modified with SARS-CoV-2 ear protein, were performed as previously described.3 Mean serum neutralizing antibody titers (50% neutralization test [NT50]) was calculated as the average of three independent experiments, each performed using technical duplicates, and statistical significance was determined with the two-tailed Mann-Whitney test.
Entire viral RNA genome sequence
Total RNA was extracted as described above, and a meta-transcriptomic library was set up for a paired sequence (150 bp read) using an Illumina MiSeq platform. Libraries have been prepared using the SureSelect XT HS2 DNA system (Agilent Technologies) and the Community Design Pan Human Coronavirus Panel (Agilent Technologies) according to the manufacturer’s instructions. FASTQ files (a text-based format for storing a biological sequence and its corresponding quality scores) were finished using Agilent Genomics NextGen Toolkit (AGeNT) software (version 2.0.5) and used for downstream analysis. The SARS-CoV-2 genome was compiled with MEGAHIT with default parameters, and the longest sequence (30,005 nucleotides) was analyzed using Nextclade software (https://clades.nextstrain.org/) to assign clade and mutations mention. Noticed mutations were confirmed by aligning RNA sequencing on the reference genome sequence of SARS-CoV-2 (GenBank number, NC_045512) with the Burrows-Wheeler Aligner (BWA-MEM).
Patient history
Patient 1 was a healthy 51-year-old woman with no risk factors for severe Covid-19 who received the first dose of mRNA-1273 on 21 January 2021 and the second dose on 19 February. She strictly adhered to the routine. precautions. Ten hours after she received the second dose of vaccine, muscle pain developed. These symptoms disappeared the next day. On March 10 (19 days after receiving the second dose of vaccine), she developed throat, congestion and headaches, and later that day she tested positive for SARS-CoV-2 RNA at Rockefeller University. On March 11, she lost her sense of smell. Her symptoms gradually disappeared over a period of 1 week.
Patient 2 was a healthy 65-year-old woman without risk factors for severe Covid-19 who received the first dose of BNT162b2 vaccine on 19 January and the second dose on 9 February. Pain that developed in the vaccinated arm lasted 2 days. On March 3, her non-vaccinated partner tested positive for SARS-CoV-2, and on March 16, fatigue, sinus congestion, and headache developed in patient 2. On March 17, she felt worse and tested positive for SARS-CoV-2 RNA, 36 days after completion of the vaccination. Her symptoms were flat and began to resolve on March 20th.